European Heart Journal Advance Access originally published online on August 8, 2005
European Heart Journal 2005 26(22):2457-2462; doi:10.1093/eurheartj/ehi438
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene-specific modifying effects of pro-LVH polymorphisms involving the reninangiotensinaldosterone system among 389 unrelated patients with hypertrophic cardiomyopathy


1Mayo Medical School, Mayo Clinic College of Medicine, Rochester, MN, USA
2Department of Molecular Pharmacology and Experimental Therapeutics, Mayo Clinic College of Medicine, Rochester, MN, USA
3Department of Paediatric and Adolescent Medicine, Mayo Clinic College of Medicine, Rochester, MN, USA
4Department of Internal Medicine, Division of Cardiovascular Medicine, Mayo Clinic College of Medicine, Rochester, MN, USA
5Department of Paediatric and Adolescent Medicine, Division of Paediatric Cardiology, Mayo Clinic College of Medicine, Rochester, MN, USA
Received 12 January 2005; revised 16 June 2005; accepted 7 July 2005; online publish-ahead-of-print 8 August 2005.
* Corresponding author: Sudden Death Genomics Laboratory, 501 Guggenheim, 200 First Street SW, Rochester, MN 55905, USA. E-mail address: ackerman.michael@mayo.edu
| Abstract |
|---|
|
|
|---|
Aims The purpose of this study was to determine whether the deletion/insertion (D/I) polymorphism in the ACE-encoded angiotensin-converting enzyme or the pooled gene effect of five reninangiotensinaldosterone system (RAAS) polymorphisms were disease modifiers in a large cohort of unrelated patients with genotyped hypertrophic cardiomyopathy (HCM).
Methods and results Five different RAAS polymorphism genotypes were established by PCR amplification of the surrounding polymorphic regions of genomic DNA in a cohort of 389 unrelated patients comprehensively genotyped for HCM-causing mutations in eight sarcomeric/myofilament genes. Patient clinical data were archived in a database blinded both to the primary myofilament defect and the polymorphism genotype. Each patient was assessed with respect to ACE genotype as well as composite pro-left ventricular hypertrophy (LVH) RAAS polymorphism score (05). Overall, no clinical parameter correlated independently with ACE genotype. Subset analysis of the two most common genetic subtypes of HCM, MYBPC3 (myosin binding protein C) and MYH7 (beta myosin heavy chain), demonstrated a significant pro-LVH effect of DD-ACE only in patients with MYBPC3-HCM. In MYBPC3-HCM, left ventricular wall thickness was greater in patients with DD genotype (25.8±5 mm) compared with DI (21.8±4) or II genotype (20.8±5, P=0.01). Moreover, extreme hypertrophy (>30 mm) was only seen in MYBPC3-HCM patients who also hosted DD-ACE. An effect of RAAS pro-LVH score was evident only in the subgroup of patients with no previously identified myofilament mutation.
Conclusion This study demonstrates that RAAS genotypes may modify the clinical phenotype of HCM in a disease gene-specific fashion rather than indiscriminately.
Key Words: Hypertrophic cardiomyopathy ACE polymorphism Genetic testing Left ventricular hypertrophy Reninangiotensinaldosterone system
| Introduction |
|---|
|
|
|---|
Hypertrophic cardiomyopathy (HCM) is the most common identifiable cause of sudden death in the young.1 Affecting approximately one in 500 persons, one trademark of HCM is its profound genetic and phenotypic heterogeneity.1 Understood principally as a disease of the cardiac sarcomere or more specifically, the cardiac myofilament, hundreds of mutations involving at least 10 sarcomeric/myofilament genes have been identified.2,3 Matching this genetic heterogeneity, the clinical presentation can range from asymptomatic longevity to premature sudden death in childhood accompanied by heterogeneous morphological characteristics ranging from extreme asymmetric septal hypertrophy with marked left ventricular outflow tract obstruction (LVOTO) to mild non-obstructive concentric hypertrophy.
Numerous important genotypephenotype associations have been identified from multi-generational family studies.413 However, we demonstrated in a large cohort of unrelated patients that the two most common genetic subtypes of HCM: MYBPC3-HCM (myosin binding protein C) and MYH7-HCM (beta myosin heavy chain) were indistinguishable with respect to age at diagnosis, degree of hypertrophy, and family history of sudden cardiac death.14 In addition, a wide spectrum of phenotypes are expressed by individuals with the same genetic substrate for disease.14 This indicates that disease course is not solely determined by the pathogenic gene. Moreover, within individual HCM families where the putative mutation is presumably identical in affected members, the clinical presentation of HCM can vary significantly.15,16 Environmental influences as well as genetic modifiers that could influence the clinical presentation of HCM have been pursued.15,1722
In particular, polymorphisms in the reninangiotensinaldosterone system (RAAS) have been considered as potential disease modifiers in HCM, as the RAAS plays a critical role in cardiovascular physiology and disease. The deletion/insertion (D/I) polymorphism in the angiotensin-converting enzyme (ACE) has been associated with several cardiovascular disorders including left ventricular hypertrophy (LVH) in untreated hypertension, complications of atherosclerosis,17 and HCM.15,1822 Patients with DD genotype have increased tissue levels of ACE and may therefore have increased levels of the trophic factor, angiotensin II, which may lead to increased hypertrophy and fibrosis.17 DD-ACE is considered a pro-LVH modifier in HCM.18
However, the independent effect of the D/I-ACE genotype in a large cohort of unrelated patients with HCM is unknown. Therefore, one objective of this study was to determine whether or not ACE genotype was associated independently with a specific phenotype in a large cohort of unrelated patients. In addition, as the primary myofilament mutation is now known for these patients, we also sought to determine whether ACE polymorphism status modified disease severity indiscriminately or in a sarcomere/myofilament gene-specific fashion.
In addition to ACE D/I status in isolation, the pooled effect of ACE and four additional genes in the RAAS have also been implicated as potential modifiers of ventricular hypertrophy in HCM. Increased burden of pro-LVH genotypes in five RAAS genes with common polymorphisms has been associated with increased hypertrophy in one family with MYBPC3-HCM.18 The four additional polymorphisms are (1) an A/C substitution at position 1666 of the angiotensin II receptor Type 1 gene (AGTR1),23,24 (2) an A/G exchange at position 1903 of the cardiac chymase A gene (CMA),25 (3) a M235T missense mutation in the gene encoding angiotensinogen (AGT),26 and (4) a C/T exchange at position 344 in the aldolase synthase gene (CYP11B2).27 A secondary aim of this study was to determine whether the composite burden of all five of these polymorphisms exerted any gene-specific effects in our large cohort of genotyped, unrelated HCM.
| Methods |
|---|
|
|
|---|
From April 1997 to December 2001, 434 patients were evaluated at the Mayo Clinic's HCM Clinic in Rochester, Minnesota. Using standard clinical assessment of family history based on patient recall, relatedness was excluded through three degrees (i.e. first degree, parent or sibling; second degree, grandparent, aunt, or uncle; third degree, great-grandparent, cousin, etc.), resulting in the exclusion of 45 relatives. When related individuals were identified, the patient who was evaluated at this institution first was included for analysis. This study was therefore confined to 389 unrelated patients, who provided informed written consent in accordance with study protocols approved by the Mayo Foundation Institutional Review Board and in compliance with the Declaration of Helsinki.
All patients met clinical HCM diagnostic criteria: left ventricular wall thickness (LVWT) greater than normal range for age and body surface area in the absence of another confounding diagnosis. Patients provided a blood sample for molecular genetic testing. The presence of a putative HCM-causing variant was determined previously following comprehensive mutational analysis of eight genes that account for over 95% of all HCM where there is an identifiable sarcomeric/myofilament genotype.14,28,29
Clinical database
Clinical information was archived in the HCM Clinic database independent to both primary pathogenic mutations and RAAS genotype status. Clinical parameters including the presence of symptoms at diagnosis, maximum LVWT, LVOTO, history of myectomy, and placement of implantable cardioverter defibrillator (ICD) were extracted from patient records and from data derived from standard transthoracic echocardiography.
Genotyping
Patient genomic DNA was extracted from peripheral blood lymphocytes using Purgene DNA extraction kits (Gentra, Inc., Minneapolis, MN, USA). The ACE genotype (DD/DI/II) was determined by PCR amplification of the polymorphic region in intron 16 of the ACE gene. PCR reactions were performed in 20 µL volumes using 50 ng DNA, 16 pmol of each primer (sense primer 5' CTGGAGACCACTCCCATCCTTTCT 3' and antisense primer 5' GATGTGGCCATCACATTCGTCAGAT 3'),15 200 µM of each dNTP, 50 mmol/L KCl, 10 mmol/L TrisHCl (pH 8.3), 2.0 mmol/L MgCl2, 1.0 U AmpliTaq Gold (Perkin-Elmer). Glycerol (10%) was added to enhance amplification of the I allele. PCR products were separated by electrophoresis on 3% agarose gel and visualized with ethidium bromide staining. As the ACE polymorphism generates a D or I amplicon, the D and I alleles were distinguished as 190 and 490 bp bands, respectively. Genotyping of AGTR1, CMA, AGT, and CYP11B2 proceeded in a similar fashion (primer sequences and PCR methods available upon request). Pro-LVH polymorphisms were defined as DD-ACE, CC-AGTR1, AA-CMA, M235T-AGT, and CC-CYP11B2.18
Statistical analysis
The primary interest was to describe the phenotype associated with ACE polymorphism status among patients with HCM. ANOVA and contingency table testing followed by Fisher's PLSD post hoc analysis were used to assess for differences across the three possible groups (DD, DI, and II) regardless of myofilament genotype status. Secondary analyses, prospectively defined, were (a) to assess if ACE status affected clinical phenotype among MYH7-HCM patients only, (b) to assess if ACE status affected clinical phenotype among MYBPC3-HCM patients only, and (c) to assess if ACE status affected clinical phenotype among those with no identified myofilament mutations (myofilament genotype-negative patients). Data were analysed independently for each gene, in addition to a pooled, five-gene pro-LVH score'18 using unpaired t-tests, ANOVA, Fisher's PLSD, and contingency tables. Subgroups were defined as earlier (ac). For all statistical tests, two-sided analysis was performed, and a P-value of <0.05 was considered statistically significant.
| Results |
|---|
|
|
|---|
In this cohort of 389 unrelated patients with HCM, the average age at diagnosis was 41.3±19 years, the majority were male (215), and the majority had at least one clinical feature indicative of severe phenotypic expression: age <25 years at diagnosis, LVWT >30 mm, LVOTO >30 mmHg, myectomy or ICD placement, or family history of sudden cardiac death involving a first-degree relative. Nearly 40% (n=147) of these patients had a putative HCM-causing myofilament variant identified.14,28,29 Among this subset with genotype positive HCM, 80% were due to single perturbations in the MYBPC3-encoded myosin binding protein C or the MYH7-encoded beta myosin heavy chain. Ethnicity of the cohort by patient self-report was as follows: Caucasian/white 331 (85%), Asian 5 (1%), Black 4 (1%), Latin 1 (<1%), Middle Eastern 1 (<1%), other 7 (2%), and unreported 40 (10%).
One hundred and ten patients (28%) were homozygous for DD-ACE, 193 (50%) were DI-ACE, and 86 (22%) were II-ACE, consistent with the distribution of ACE genotypes demonstrated in previous population-based epidemiological studies.17 There was no statistical association or interaction between ACE polymorphism status and the sarcomere myofilament genotype (P=0.16). Independent of the underlying HCM-causing genetic substrate, there was no discernible effect of ACE polymorphism on the clinical phenotype of this cohort with regard to any clinical variable (Table 1). The average age at diagnosis was 38.5±17 years for DD, 42.6±18 for DI, and 42.3±20 for II (P=0.19). There was no difference in the degree of LVH as assessed by two-dimensional maximum LVWT for HCM patients with DD-ACE (22.7±7 mm) compared with 21.4±6 mm for DI and 20.9±7 mm for II (P=0.12). The extent of LVOTO was not different between DD, DI, and II individuals (50.3±45 vs. 44.4±42 vs. 47.4±41 mmHg, P=0.53). There was no difference in history of surgical myectomy among the three groups (45 vs. 42 vs. 33%, P=0.16) for DD, DI, and II, respectively or presence of an ICD (18 vs. 16 vs. 10%, P=0.31).
|
Because of the marked genetic heterogeneity with respect to the primary HCM-causing genetic substrate, subset analysis of the two most commonly identified HCM-associated myofilament genotypes, MYBPC3-HCM and MYH7-HCM, was performed. In this cohort, these two genotypes are not statistically different on the basis of clinical criteria of LVWT, LVOTO, or age at diagnosis.14 Among patients with single mutations in MYBPC3 (n=63), DD-ACE was a significant pro-LVH modifier (Figure 1). LVWT was substantially greater in the MYBPC3-HCM subset with DD-ACE (25.8±5 mm) compared with those with DI-ACE (21.8±4 mm) or II-ACE (20.8±5 mm, P=0.01). Additionally, there were four patients with MYBPC3-HCM showing extreme hypertrophy (LVWT >30 mm) and all were DD-ACE (P=0.001).
|
In contrast, there was no discernible modifying influence of ACE polymorphism among patients with single mutations involving MYH7 (n=54). Specifically, a pro-LVH effect of DD-ACE was not seen. The LVWT was 24.4±8, 22.8±7, and 25.6±6 mm in DD, DI, and II respectively, (P=0.64, Figure 1). There were eight MYH7-HCM patients with LVWT >30 mm and only four were DD-ACE (P=NS). In addition, the phenotype of the largest subset having no identifiable myofilament mutation (myofilament genotype-negative) was not influenced by ACE genotype (Figure 1).
The frequency of the additional four RAAS polymorphisms in our HCM cohort were also similar to those reported in other study populations (AGTR1 CC 10.0, CMA AA 24.6, AGT M235T 18.8, and CYP11B2 CC 21.2%).18,24,25,27,30 No single polymorphism predicted the degree of LVH or any other clinical phenotype (P=NS; Table 2). On the basis of the number of pro-LVH RAAS polymorphisms present, a pro-LVH score was also determined for each individual (05). Overall, an increasing pro-LVH RAAS genotype burden did not correlate with an increase in LVWT (P=0.09; Table 3). Further analysis revealed that an increase in LVWT was significant only in the subgroup of individuals without an identifiable myofilament mutation (P=0.02; Table 3). In fact, statistical significance was reached only in comparison of the two individuals possessing a pro-LVH score of four, one of which was shown to have severe hypertrophy with a LVWT of 40 mm, to those with scores of 0, 1, 2, or 3.
|
|
| Discussion |
|---|
|
|
|---|
Polymorphisms in RAAS, particularly the DD-ACE genotype, may be key determinants in the phenotypic expression of various cardiovascular disorders, including HCM. DD-ACE is considered a pro-LVH genotype in HCM.15,17,18,20,22 Tissue levels of ACE are increased in patients with DD-ACE.17
Previously, smaller HCM cohort studies found that the D allele was over-represented in cohorts of HCM patients.19,21 Lechin et al.15 suggested a pro-LVH effect of DD-ACE in a study comprising 108 unrelated patients with HCM. However, the primary HCM-causing genetic substrate was not elucidated in this study. Among a small subset of unrelated patients harbouring the same R403Q missense mutation in MYH7, DD-ACE was associated with disease severity.22 In other family studies involving affected family members who presumably harboured the same pathogenic mutation, ACE genotype influenced the degree of hypertrophy.20
In this large cohort of unrelated HCM patients, the prevalence of the D allele was not over-represented but reflected the distribution of genotype established in normal population-based studies, both for the entire cohort and for each specific HCM genotype. For the cohort at large and at variance with previous studies involving smaller patient cohorts, there was no discernible effect of ACE polymorphism status on the clinical phenotype.
However, a significant pro-LVH effect was seen among patients with MYBPC3-HCM but not MYH7-HCM. These genotype-based subgroups were defined post hoc. Whether or not DD-ACE exhibits a pro-hypertrophic effect in the setting of thin myofilament-HCM (troponin T, alpha tropomyosin, troponin I, or actin) is unknown and could not be addressed in our cohort because only 13 patients had a thin myofilament genotype. Moreover, owing to the genetic heterogeneity in this cohort, potential ACE polymorphism effects on specific mutations could not be assessed, but may be present.
Given that the clinical phenotypes between the two most common genetic subtypes of HCM (MYBPC3 and MYH7) are very similar, it is unclear why the pro-LVH effect of DD-ACE was gene-specific. Indeed, given that no ACE effect on LVWT was found in the analysis of the HCM cohort as a whole, significant findings in subgroups must be viewed cautiously. However, consistent with our findings, DD-ACE exhibited a marked pro-LVH effect in a single, large family with MYBPC3-mediated HCM.22 It will be interesting to further study the families represented by the 147 sarcomere/myofilament genotype positive index cases in our study and determine whether this intra-family influence of ACE genotype persists in a gene-specific manner.
In addition, DD-ACE is only one of the several pro-LVH candidate polymorphisms in RAAS.18 Previously, Ortlepp et al.18 examined the effect of five pro-LVH RAAS genotypes in a single family with HCM secondary to a MYBPC3 mutation and discovered that increased cardiac hypertrophy was associated with the burden of pro-LVH genotypes. Sixty-three individuals in our cohort possessed MYBPC3-HCM and, although a trend was present, increased pro-LVH RAAS genotype score did not significantly influence the degree of hypertrophy. Likewise, no difference was seen in the cohort as a whole (regardless of presence or absence of a myofilament mutation). An increase in ventricular wall thickness was seen, however, when analysing the subgroup that had no identifiable HCM-causing mutation (myofilament genotype-negative). The genetic and phenotypic heterogeneity in our study population may have necessitated the pooling of multiple RAAS polymorphisms to provide sufficient power to discern any single, pro-LVH gene effect. Admittedly, the statistical significance observed depended on the inclusion of one individual with severe ventricular hypertrophy who possessed four pro-LVH RAAS polymorphisms. Whether or not the pooled burden of multiple RAAS polymorphisms has any clinical significance in HCM remains unclear.
Whether or not these gene-specific responses associated with the modifying influence of ACE polymorphism translate to enlightened therapeutic management of patients with HCM will require further investigation. Although a statistically significant difference in LVWT was found in some patient subgroups, the biological relevance of ACE genotype is yet to be determined. As we have demonstrated previously, knowledge of the primary HCM-causing genetic substrate will likely play a critical role in the detection of individuals with genotype positive HCM prior to their manifestation of detectable clinical disease but will not provide risk stratification.16,31,32 It is conceivable that knowledge of ACE genotype could be translated to patient benefit. Perhaps, patients who are DD-ACE and have non-obstructive HCM pursuant to MYBPC3 mutations may derive the greatest clinical benefit from ACE inhibitor therapy. This rational but untested hypothesis warrants further investigation.
| Acknowledgements |
|---|
|
|
|---|
We are indebted to the patients with HCM for their participation in this study. We would like to thank Dr Rick Nishimura for his critical reading of the manuscript and Mr Doug Kocer, nurse co-ordinator for the HCM Clinic. Dr Ackerman's research programme is supported by the Mayo Foundation, the Dr Scholl Foundation, the CJ Foundation for SIDS, a Clinical Scientist Development Award from the Doris Duke Charitable Foundation, an Established Investigator Award from the American Heart Association, and the National Institutes of Health (HD42569).
| Footnotes |
|---|
Co-equal first authors. | References |
|---|
|
|
|---|
- Maron BJ, Gardin JM, Flack JM, Gidding SS, Kurosaki TT, Bild DE. Prevalence of hypertrophic cardiomyopathy in a general population of young adults. Echocardiographic analysis of 4111 subjects in the CARDIA study. Coronary artery risk development in (young) adults. Circulation 1995;92:785789.
[Abstract/Free Full Text] - Spirito P, Seidman CE, McKenna WJ, Maron BJ. The management of hypertrophic cardiomyopathy. N Engl J Med 1997;336:775785.
[Free Full Text] - Seidman JG, Seidman C. The genetic basis for cardiomyopathy: from mutation identification to mechanistic paradigms. Cell 2001;104:557567.[CrossRef][Web of Science][Medline]
- Marian AJ, Roberts R. Molecular genetic basis of hypertrophic cardiomyopathy: genetic markers for sudden cardiac death. J Cardiovasc Electrophysiol 1998;9:8899.[Web of Science][Medline]
- Roberts R, Sigwart U. New concepts in hypertrophic cardiomyopathies, part I. Circulation 2001;104:21132116.
[Free Full Text] - Anan R, Greve G, Thierfelder L, Watkins H, McKenna WJ, Solomon S, Vecchio C, Shono H, Nakao S, Tanaka H, Mares AJ, Towbin JA, Spirito P, Roberts R, Seidman JG, Seidman CE. Prognostic implications of novel beta cardiac myosin heavy chain gene mutations that cause familial hypertrophic cardiomyopathy. J Clin Invest 1994;93:280285.[Web of Science][Medline]
- Watkins H, Rosenzweig A, Hwang DS, Levi T, McKenna W, Seidman CE, Seidman JG. Characteristics and prognostic implications of myosin missense mutations in familial hypertrophic cardiomyopathy. N Engl J Med 1992;326:11081114.[Abstract]
- Marian AJ, Mares A Jr, Kelly DP, Yu QT, Abchee AB, Hill R, Roberts R. Sudden cardiac death in hypertrophic cardiomyopathy. Variability in phenotypic expression of beta-myosin heavy chain mutations. Eur Heart J 1995;16:368376.
[Abstract/Free Full Text] - Consevage MW, Salada GC, Baylen BG, Ladda RL, Rogan PK. A new missense mutation, Arg719Gln, in the beta-cardiac heavy chain myosin gene of patients with familial hypertrophic cardiomyopathy. Hum Mol Genet 1994;3:10251026.
[Free Full Text] - Coviello DA, Maron BJ, Spirito P, Watkins H, Vosberg HP, Thierfelder L, Schoen FJ, Seidman JG, Seidman CE. Clinical features of hypertrophic cardiomyopathy caused by mutation of a "hot spot" in the alpha-tropomyosin gene. J Am Coll Cardiol 1997;29:635640.[Abstract]
- Ho CY, Lever HM, DeSanctis R, Farver CF, Seidman JG, Seidman CE. Homozygous mutation in cardiac troponin T: implications for hypertrophic cardiomyopathy. Circulation 2000;102:19501955.
[Abstract/Free Full Text] - Hwang T, Lee W, Kimura A, Satoh M, Nakamura T, Kim M, Choi S, Park J. Early expression of a malignant phenotype of familial hypertrophic cardiomyopathy associated with a Gly716Arg myosin heavy chain mutation in a Korean family. Am J Cardiol 1998;82:15091513.[CrossRef][Web of Science][Medline]
- Moolman JC, Corfield VA, Posen B, Ngumbela K, Seidman C, Brink PA, Watkins H. Sudden death due to troponin T mutations. J Am Coll Cardiol 1997;29:549555.[Abstract]
- Van Driest SL, Vasile VC, Ommen SR, Will ML, Gersh BJ, Nishimura RA, Tajik AJ, Ackerman MJ. Myosin binding protein C mutations and compound heterozygosity in hypertrophic cardiomyopathy. J Am Coll Cardiol 2004;44:19031910.
[Abstract/Free Full Text] - Lechin M, Quinones MA, Omran A, Hill R, Yu QT, Rakowski H, Wigle D, Liew C, Sole M, Roberts R, Marian A. Angiotensin-I converting enzyme genotypes and left ventricular hypertrophy in patients with hypertrophic cardiomyopathy. Circulation 1995;92:18081812.
[Abstract/Free Full Text] - Van Driest SL, Will ML, Atkins DL, Ackerman MJ. A novel TPM1 mutation in a family with hypertrophic cardiomyopathy and sudden cardiac death in childhood. Am J Cardiol 2002;90:11231127.[CrossRef][Web of Science][Medline]
- Wang JG, Staessen JA. Genetic polymorphisms in the reninangiotensin system: relevance for susceptibility to cardiovascular disease. Eur J Pharm 2000;410:289302.[CrossRef][Web of Science][Medline]
- Ortlepp JR, Vosberg HP, Reith S, Ohme F, Mahon NG, Schroder D, Klues HG, Hanrath P, McKenna WJ. Genetic polymorphisms in the reninangiotensinaldosterone system associated with expression of left ventricular hypertrophy in hypertrophic cardiomyopathy: a study of five polymorphic genes in a family with a disease causing mutation in the myosin binding protein C gene. Heart 2002;87:270275.
[Abstract/Free Full Text] - Yoneya K, Okamoto H, Machida M, Onozuka H, Noguchi M, Mikami T, Kawaguchi H, Murakami M, Uede T, Kitabatake A. Angiotensin-converting enzyme gene polymorphism in Japanese patients with hypertrophic cardiomyopathy. Am Heart J 1995;130:10891093.[CrossRef][Web of Science][Medline]
- Marian AJ, Yu QT, Workman R, Greve G, Roberts R. Angiotensin-converting enzyme polymorphism in hypertrophic cardiomyopathy and sudden cardiac death. Lancet 1993;342:10851086.[CrossRef][Web of Science][Medline]
- Lopez-Haldon J, Garcia-Lozano JR, Martinez Martinez A, Nunez-Roldan A, Burgos Cornejo J. The effect of polymorphisms of the angiotensin-converting enzyme and angiotensinogen genes on the phenotypic expression of Spanish patients with hypertrophic cardiomyopathy. Medicina Clinica 1999;113:161163.[Medline]
- Tesson F, Dufour C, Moolman JC, Carrier L, al-Mahdawi S, Chojnowska L, Dubourg O, Soubrier E, Brink P, Komajda M, Guicheney P, Schwartz K, Feingold J. The influence of the angiotensin I converting enzyme genotype in familial hypertrophic cardiomyopathy varies with the disease gene mutation. J Mol Cell Cardiol 1997;29:831838.[CrossRef][Web of Science][Medline]
- Brugada R, Kelsey W, Lechin M, Zhao G, Yu QT, Zoghbi W, Quinones M, Elstein E, Omran A, Rakowski H, Wigle D, Liew CC, Sole M, Roberts R, Marian AJ. Role of candidate modifier genes on the phenotypic expression of hypertrophy in patients with hypertrophic cardiomyopathy. J Invest Med 1997;45:542551.[Web of Science][Medline]
- Osterop AP, Kofflard MJ, Sandkuijl LA, ten Cate FJ, Krams R, Schalekamp MA, Danser AH. At1 receptor A/C1166 polymorphism contributes to cardiac hypertrophy in subjects with hypertrophic cardiomyopathy. Hypertension 1998;32:825830.
[Abstract/Free Full Text] - Pfeufer A, Osterziel KJ, Urata H, Borck G, Schuster H, Wienker T, Dietz R, Luft FC. Angiotensin-converting enzyme and heart chymase gene polymorphisms in hypertrophic cardiomyopathy. Am J Cardiol 1996;78:362364.[CrossRef][Web of Science][Medline]
- Ishanov A, Okamoto H, Yoneya K, Watanabe M, Nakagawa I, Machida M, Onozuka H, Mikami T, Kawaguchi H, Hata A, Kondo K, Kitabatake A. Angiotensinogen gene polymorphism in Japanese patients with hypertrophic cardiomyopathy. Am Heart J 1997;133:184189.[CrossRef][Web of Science][Medline]
- Kupari M, Hautanen A, Lankinen L, Koskinen P, Virolainen J, Nikkila H, White PC. Associations between human aldosterone synthase (CYP11B2) gene polymorphisms and left ventricular size, mass, and function. Circulation 1998;97:569575.
[Abstract/Free Full Text] - Van Driest SL, Jaeger MA, Ommen SR, Will ML, Gersh BJ, Tajik AJ, Ackerman MJ. Comprehensive analysis of the beta myosin heavy chain gene in 389 unrelated patients with hypertrophic cardiomyopathy. J Am Coll Cardiol 2004;44:602610.
[Abstract/Free Full Text] - Van Driest SL, Ellsworth EG, Ommen SR, Tajik AJ, Gersh BJ, Ackerman MJ. Prevalence and spectrum of thin filament mutations in an outpatient referral population with hypertrophic cardiomyopathy. Circulation 2003;108:445451.
[Abstract/Free Full Text] - Hegele RA, Brunt JH, Connelly PW. A polymorphism of the angiotensinogen gene associated with variation in blood pressure in a genetic isolate. Circulation 1994;90:22072212.
[Abstract/Free Full Text] - Ackerman MJ, Van Driest SV, Ommen SR, Will ML, Nishimura RA, Tajik AJ, Gersh BJ. Prevalence and age-dependence of malignant mutations in the beta-myosin heavy chain and troponin T gene in hypertrophic cardiomyopathy: a comprehensive outpatient perspective. J Am Coll Cardiol 2002;39:20422048.
[Abstract/Free Full Text] - Van Driest SV, Ackerman MJ, Ommen SR, Shakur R, Will ML, Nishimura RA, Tajik AJ, Gersh BJ. Prevalence and severity of "benign" mutations in the beta myosin heavy chain, cardiac troponin-T, and alpha tropo-myosin genes in hypertrophic cardiomyopathy. Circulation 2002;106:30853090.
[Abstract/Free Full Text]
This article has been cited by other articles:
![]() |
S. R. Auerbach, C. Manlhiot, S. Reddy, C. Kinnear, M. E. Richmond, D. Gruber, B. W. McCrindle, L. Deng, J. M. Chen, L. J. Addonizio, et al. Recipient Genotype Is a Predictor of Allograft Cytokine Expression and Outcomes After Pediatric Cardiac Transplantation J. Am. Coll. Cardiol., May 19, 2009; 53(20): 1909 - 1917. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Kaludercic, C. Reggiani, and N. Paolocci Genes, Geography and Geometry: The "Critical Mass" in Hypertrophic Cardiomyopathy J. Mol. Diagn., January 1, 2009; 11(1): 12 - 16. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Penicka, P. Gregor, R. Kerekes, D. Marek, K. Curila, J. Krupicka, and for the Candesartan use in Hypertrophic And Non-ob The Effects of Candesartan on Left Ventricular Hypertrophy and Function in Nonobstructive Hypertrophic Cardiomyopathy: A Pilot, Randomized Study J. Mol. Diagn., January 1, 2009; 11(1): 35 - 41. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Richard, E. Villard, P. Charron, and R. Isnard The Genetic Bases of Cardiomyopathies J. Am. Coll. Cardiol., October 27, 2006; 48(9_Suppl_A): A79 - A89. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||


